pdhA [2019-02-24 17:45:36]

pyruvate dehydrogenase (E1 alpha subunit), required for Z-ring assembly in a pyruvate-dependent manner

Locus: BSU14580

Isoelectric point: 5.84

Molecular weight: 41.39 kDa

Protein length: 371 aa

Gene length: 1116 bp

Function: links glycolysis and TCA cycle

Product: pyruvate dehydrogenase (E1 alpha subunit)

Essential: no

E.C.: 1.2.4.1

Synonyms: aceA

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → TCA cycle

Gene

Coordinates: 1,528,326 1,529,441

Phenotypes of a mutant

• pdhA is essential according to Kobayashi et al. PubMed, non-essential according to PubMed
• the mutant grows slowly but is viable PubMed
• depletion of pdhA and deletion of ezrA have a strong synthetic defect in cell division PubMed

The protein

Catalyzed reaction/ biological activity

• Pyruvate [dihydrolipoyllysine-residue acetyltransferase] lipoyllysine = [dihydrolipoyllysine-residue acetyltransferase] S-acetyldihydrolipoyllysine CO₂ (according to Swiss-Prot)

Paralogous protein(s)

• BkdAA, AcoA

Kinetic information

• Michaelis-Menten PubMed

Cofactors

• thiamine pyrophosphate

Effectors of protein activity

• Inhibited thiamine 2-thiothiazolone diphosphate and NADH PubMed
• Low sensibility to NADPH

Structure

• 1W88 (E1 in complex with subunit binding domain of E2, Geobacillus stearothermophilus)

Localization

• colocalizes with the nucleoid (depending on the availability of pyruvate) PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: pdhA-pdhB-pdhC-pdhD
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • stringent response: negative regulation, due to presence of guanine at 1 position of the transcript PubMed, in stringent response

  Regulation

  • pdhA: expression activated by glucose (1.9-fold) PubMed

Biological materials

Mutant

• BKE14580 (pdhA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA
• BKK14580 (pdhA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATACTAAGTCACCTCTTCC, downstream forward: _UP4_ACACAGAAGGAGTCGAAGTA

LacZ fusion

• pGP721 (in pAC5), available in Jörg Stülke's lab, pGP186 (in pAC7), available in Jörg Stülke's lab

Labs working on this gene/protein

• Arthur Aronson, Purdue University, West Lafayette, USA homepage

References

Reviews

Loading

Original publications

Loading